pMSP3545-dCas9Str
(Plasmid
#153516)
-
PurposeExpresses dCas9str under nisin-inducible nisA promoter in pMSP3545 backbone
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | ||
---|---|---|---|---|---|---|
Plasmid | 153516 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepMSP3545
-
Backbone manufacturerGary Dunny
- Backbone size w/o insert (bp) 8514
- Total vector size (bp) 12621
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)erythromycin
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionserm 100
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namedCas9Str
-
Speciesinactivated dCas9 from Streptococcus pneumoniae
- Promoter nisA
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer cagcgagtcagtgagcgag
- 3′ sequencing primer cgcgagcataataaacggctc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Terms and Licenses
-
Industry Terms
- Not Available to Industry
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMSP3545-dCas9Str was a gift from Kimberly Kline (Addgene plasmid # 153516 ; http://n2t.net/addgene:153516 ; RRID:Addgene_153516)