-
PurposeExpression of a catalytically inactive, human codon-optimized Cas9 under the control of Murine Stem Cell retroVirus LTR promoter for mammalian gene knockdown
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | ||
---|---|---|---|---|---|---|
Plasmid | 44246 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepMSCVpuro
-
Backbone manufacturerClontech
- Total vector size (bp) 10477
-
Vector typeMammalian Expression, Retroviral, CRISPR ; vector
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namedead Cas9 with 3X NLS
-
Alt nameCatalytically inactive Cas9
-
SpeciesH. sapiens (human)
-
Insert Size (bp)4188
-
MutationD10A H840A (catalytically inactive)
- Promoter MSCV LTR promoter
-
Tag
/ Fusion Protein
- 3x NLS (C terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer CCGGAATTAGATCTCGCCACCATGGAC
- 3′ sequencing primer CCGGTAGAATTCTATACCTTTCTCTTCT (Common Sequencing Primers)
Resource Information
-
Terms and Licenses
-
Industry Terms
- Not Available to Industry
-
Articles Citing this Plasmid
Depositor Comments
The dCas9 contains an N612K mutation that does not effect function.
For more information on Qi Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/qi/
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pdCas9-humanized was a gift from Stanley Qi (Addgene plasmid # 44246 ; http://n2t.net/addgene:44246 ; RRID:Addgene_44246) -
For your References section:
Repurposing CRISPR as an RNA-Guided Platform for Sequence-Specific Control of Gene Expression. Qi LS, Larson MH, Gilbert LA, Doudna JA, Weissman JS, Arkin AP, Lim WA. Cell. 2013 Feb 28;152(5):1173-83. doi: 10.1016/j.cell.2013.02.022. 10.1016/j.cell.2013.02.022 PubMed 23452860