Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pSLQ1658-dCas9-EGFP
(Plasmid #51023)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 51023 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pMSCVpuro
  • Total vector size (bp) 11177
  • Modifications to backbone
    None
  • Vector type
    Mammalian Expression, Retroviral, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    We suggest using Stellar (Clontech) for growth
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    dCas9 fuse to EGFP
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    4887
  • Promoter MSCV LTR promoter
  • Tag / Fusion Protein
    • EGFP (C terminal on insert)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer ctcgatcctccctttatccagcc
  • 3′ sequencing primer ggctgctaaagcgcatgct
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSLQ1658-dCas9-EGFP was a gift from Bo Huang & Stanley Qi (Addgene plasmid # 51023 ; http://n2t.net/addgene:51023 ; RRID:Addgene_51023)
  • For your References section:

    Dynamic Imaging of Genomic Loci in Living Human Cells by an Optimized CRISPR/Cas System. Chen B, Gilbert LA, Cimini BA, Schnitzbauer J, Zhang W, Li GW, Park J, Blackburn EH, Weissman JS, Qi LS, Huang B. Cell. 2013 Dec 19;155(7):1479-91. doi: 10.1016/j.cell.2013.12.001. 10.1016/j.cell.2013.12.001 PubMed 24360272