- Journal List
- Europe PMC Author Manuscripts
- PMC5898607
CRISPR/Cas9 Beta-globin Gene Targeting in Human Hematopoietic Stem Cells
Daniel P. Dever
1Department of Pediatrics, Stanford University, Stanford, CA 94305, USA
Rasmus O. Bak
1Department of Pediatrics, Stanford University, Stanford, CA 94305, USA
Andreas Reinisch
2Department of Medicine, Division of Hematology, Cancer Institute, and Institute for Stem Cell Biology and Regenerative Medicine, Stanford University, Stanford, CA 94305, USA
Joab Camarena
1Department of Pediatrics, Stanford University, Stanford, CA 94305, USA
Gabriel Washington
1Department of Pediatrics, Stanford University, Stanford, CA 94305, USA
Carmencita E. Nicolas
1Department of Pediatrics, Stanford University, Stanford, CA 94305, USA
Mara Pavel-Dinu
1Department of Pediatrics, Stanford University, Stanford, CA 94305, USA
Nivi Saxena
1Department of Pediatrics, Stanford University, Stanford, CA 94305, USA
Alec B. Wilkens
1Department of Pediatrics, Stanford University, Stanford, CA 94305, USA
Sruthi Mantri
1Department of Pediatrics, Stanford University, Stanford, CA 94305, USA
Nobuko Uchida
4Stem Cells, Inc. 7707 Gateway Blvd., Suite 140, Newark, CA 94560 USA
Ayal Hendel
1Department of Pediatrics, Stanford University, Stanford, CA 94305, USA
Anupama Narla
3Division of Hematology/Oncology, Department of Pediatrics, Stanford University School of Medicine, Stanford, CA, USA
Ravindra Majeti
2Department of Medicine, Division of Hematology, Cancer Institute, and Institute for Stem Cell Biology and Regenerative Medicine, Stanford University, Stanford, CA 94305, USA
Kenneth I. Weinberg
1Department of Pediatrics, Stanford University, Stanford, CA 94305, USA
Matthew H. Porteus
1Department of Pediatrics, Stanford University, Stanford, CA 94305, USA
Associated Data
- Supplementary Materials
- GUID: 037AE07F-8755-46A9-B98A-93D8E1DD47A7
Abstract
The β-hemoglobinopathies, including sickle cell disease (SCD) and β-thalassemia, are caused by mutations in the β-globin gene (HBB) and affect millions of people worldwide. A curative strategy for the β-hemoglobinopathies would be ex vivo gene correction in patient-derived hematopoietic stem cells (HSCs) followed by autologous transplantation. Here we report the first CRISPR/Cas9 gene-editing platform for achieving homologous recombination (HR) at the HBB gene in HSCs by combining Cas9 ribonucleoproteins and rAAV6 HR donor delivery. Notably, we devise an enrichment paradigm to purify a population of HSPCs with >90% targeted integration. We also show efficient correction of the SCD-causing E6V mutation in patient-derived HSPCs that after differentiation into erythrocytes, express adult β-globin (HbA) mRNA, confirming intact transcriptional regulation of edited HBB alleles. Collectively, these preclinical studies outline a CRISPR-based methodology for targeting HSCs by HR at the HBB locus to advance the development of next generation therapies for β-hemoglobinopathies.
Allogeneic hematopoietic stem cell transplantation (allo-HSCT) highlights the idea that transplantation of HSCs with only a single wild-type b-globin gene (HBB) can cure the b-hemoglobinopathies; however, allo-HSCT is limited because of graft versus host disease and lack of immunologically matched donors. An alternative to using allogeneic HSCs to cure the b-hemoglobinopathies is to use homologous recombination (HR) to directly modify the HBB gene in the patient’s own HSCs1, 2. The first step towards this was described in 1985 when Smithies and colleagues were able to modify the human HBB gene by HR in a human embryonic carcinoma cell line, albeit at an extremely low frequency3 (10-6). The subsequent discoveries that a site-specific DNA double-strand break (DSB) could stimulate HR-mediated correction of a reporter gene and that engineered nucleases could be used to induce this DSB, formed the foundation of using HR-mediated genome editing using engineered nucleases to directly modify the HBB gene4, 5. The ease of engineering as well as the robust activity of the CRISPR/Cas9 RNA-guided endonuclease system makes it a promising tool to apply to the ongoing challenge of developing effective and safe HR-mediated genome editing to cure b-hemoglobinopathies7, 8.
The CRISPR/Cas9 complex consists of the Cas9 endonuclease and a 100-nucleotide (nt) single guide RNA (sgRNA). Target identification relies first on identification of a 3-base pair protospacer adjacent motif (PAM) and then hybridization between a 20-nucleotide stretch of the sgRNA and the DNA target site, whivh triggers Cas9 to cleave both DNA strands9. DSB formation activates two highly conserved repair mechanisms: canonical non-homologous end-joining (NHEJ) and homologous recombination10 (HR). Through iterative cycles of break and NHEJ repair, insertions and/or deletions (INDELs) can be created at the site of the break. In contrast, genome editing by HR requires the delivery of a DNA donor molecule to serve as a homologous template, which the cellular HR machinery uses to repair the break by a ‘copy and paste’ method11. For gene editing purposes, the HR pathway can be exploited to make precise nucleotide changes in the genome4. One of the key features of precise genome editing, in contrast to viral vector-based gene transfer methods, is that endogenous promoters, regulatory elements, and enhancers can be preserved to mediate spatiotemporal gene expression1, 12–14. The CRISPR/Cas9 system is highly effective at stimulating DSBs in primary human HSPCs when the sgRNA is synthesized with chemical modifications, precomplexed with Cas9, and then electroporated into cells15.
HSCs have the ability to repopulate an entire hematopoietic system16, and several genetic17–19 and acquired20 diseases of the blood could potentially be cured by genome editing of HSCs. Recent studies have demonstrated efficient targeted integration in HSPCs by combining ZFN expression with exogenous HR donors delivered via single stranded oligonucleotides (ssODN)6, integrase-defective lentiviral vectors (IDLV)21, or recombinant adeno-associated viral vectors of serotype 6 (rAAV6)22, 23. In most of these studies, however, the high editing frequencies in vitro did not result in high frequencies of edited cells following transplantation into immunodeficient mice. Moreover, in some of these studies the HSPCs used were derived from fetal liver, which is a non-clinically relevant HSPC source compared to cells derived from bone marrow or mobilized peripheral blood. Collectively, these studies suggest that targeting HSCs by HR at disease-causing loci is difficult in clinically relevant HSPCs.
In this study, we achieve efficient in vitro HR-mediated editing frequencies at the HBB locus in CD34+ HSPCs derived from mobilized peripheral blood (mPB) using Cas9 ribonucleoproteins (RNPs) combined with rAAV6 homologous donor delivery. In brief, we demonstrate: 1) Cas9 and rAAV6-mediated HBB targeting in HSCs characterized by the identification of modified human cells in secondary transplants of immunodeficient mice, 2) efficient correction of the SCD-causing E6V mutation in multiple SCD patient-derived HSPCs, and 3) development of a purification scheme using either FACS or magnetic bead enrichment to create HSPC populations in which >85% of the cells have been modified by HR-mediated targeted integration This purification can be performed early in the manufacturing process when HSCs are still preserved, and may prove valuable in a clinical setting for removing untargeted HSPCs that will be in competition with HR-edited HSPCs for engraftment and re-population following transplantation.
CRISPR/Cas9 targeted HBB gene editing in HSPCs
As other groups have reported, we confirmed high transduction of HSPCs using a self-complementary AAV6 (scAAV6) with an SFFV-GFP expression cassette24 (Extended Data Fig 1A). HBB-specific single-stranded AAV6 (ssAAV6) vectors were then produced containing SFFV-GFP flanked by arms homologous to HBB (Fig 1a). To achieve gene editing at HBB, we employed two different CRISPR platforms, which we have previously shown to be highly active in primary cells15. Both platforms use sgRNAs chemically modified at both termini with 2’ O-Methyl 3′phosphorothioate (MS sgRNA) and are either delivered in conjunction with Cas9 mRNA or as a ribonucleoprotein (RNP) complex. Both platforms yielded high INDEL frequencies when electroporated into HSPCs, with the RNP showing higher activity (Fig 1b). By supplying ssAAV6 HBB donors after electroporation of Cas9 RNP we achieved stable GFP expression in an average of 29% of HSPCs (Fig 1c). We observed lower efficiencies using the mRNA platform (15%) (Fig 1c). Cytotoxicity and off-target cleavage activity (of a reported off-target site)15 was significantly decreased using the RNP system (Extended Data Fig 1B-D).
Because AAV genomes can be captured at the site of an off-target DSB via NHEJ22, 25, 26, we performed experiments mismatching a nuclease with a non-homologous donor to see if this occurs with our methodology. While ~20% cells that received matched HBB nuclease and HBB donor maintained GFP expression following 18 days in culture, IL2RG nuclease combined with HBB donor resulted in 0.8% GFP+ cells (Extended Data Fig 1E-G), which was not significantly higher than the 0.5% GFP+ cells observed when using the HBB AAV donor alone. These results demonstrate that end-capture of the HBB donor is an infrequent event using this system in human HSPCs. Furthermore, the observed GFP expression in 0.5% of HSPCs with AAV donor alone suggests that random integration of rAAV6 is limited in human HSPCs. In fact, previous reports have shown AAV-mediated targeted integration without a double-strand break27, 28 and thus, these GFP expressing cells may be the result of on-target events.
SCD is caused by a single nucleotide mutation (adenine to thymine), which changes an amino acid (E6V) at codon 6 of the HBB gene29. We created a 4.5kb rAAV6 donor template that would introduce the E6V mutation along with six other silent SNPs to prevent Cas9 re-cutting of HR alleles(Extended Data Fig 2A-C). Using this rAAV6 donor with Cas9 RNP delivery we measured an average allelic modification frequency of 19% in six different HSPC donors (Fig 1d). These results confirm that the combined use of CRISPR with rAAV6 can precisely change the nucleotide at the position of the mutation that causes SCD..
Early enrichment of HBB-targeted HSPCs
Since HSCs differentiate and progressively lose their long-term repopulating capacity upon culturing, the identification of gene-edited HSPCs early in the manufacturing process would be of great use. Accordingly, in experiments using a GFP-expressing rAAV6 donor we observed that while HSPCs receiving only rAAV6 donor expressed low levels of GFP, HSPCs that also received Cas9 RNP generated a population at Day 4 post-electroporation that expressed much higher GFP levels (Fig 2a, left panel). We hypothesized that this GFPhigh population was enriched for HBB-targeted cells. We therefore sorted and cultured the GFPhigh population as well as the GFPlow and GFPneg populations. While sorted GFPlow and GFPneg populations were respectively ~25% and ~1% GFP+ after 15-20 days in culture, the GFPhigh population was >95% GFP+, strongly suggesting that this population was indeed HBB-targeted (Fig 2a, right panel). In fact, linear regression showed that the percentage of GFPhigh expressing HSPCs at Day 4 post-electroporation strongly correlates with the total percentage of GFP+ cells at Day 18 (Extended Data Fig 3).
To confirm that the GFPhigh population was enriched for on-target integration, we used ‘In-Out PCR’ (one primer binding the HBB locus outside the region of the homology arm and the other binding the integrated insert) to determine integration frequencies and allelic distribution in methylcellulose clones derived from the GFPhigh population (95 clones). A total of 92% of clones had a targeted integration, with 38% harboring biallelic integrations (Fig 2b, Extended Data Fig 4A-C, and Supplemental Figure 1A). We note, however, that this assay generates colonies from progenitor cells and that the biallelic integration rates could be different in HSCs. Nonetheless, these data highly suggest that the log-fold transgene expression shift following rAAV6 and RNP delivery is due to HR at the intended locus and that the shift allows FACS-based enrichment of HBB-targeted HSPCs.
While GFP is not a clinically relevant reporter gene, the truncated nerve growth factor receptor (tNGFR), in which the cytoplasmic intracellular signaling domain is removed, could be used to enrich for targeted HSPCs. tNGFR is expressed on the cell surface, thereby allowing antibody-mediated detection of gene marking and it has already been used in human clinical trials30–33. We examined if we could enrich HBB-targeted HSPCs using tNGFR magnetic bead-based separation technology. HSPCs that received RNP and rAAV6 donor (with a tNGFR expression cassette) produced a tNGFRhigh population that was not present in cells transduced with rAAV6 alone, consistent with our findings with a GFP cassette (Fig 2c, left panel). We then enriched tNGFRhigh cells using anti-NGFR magnetic microbeads and after 18 days in culture, an average of 84% of HSPCs were tNGFR+ (Fig 2c, right panel). We then performed ‘In/Out PCR’ on tNGFRhigh methylcellulose clones to determine on-target integration frequencies, and found that 86% of clones had a targeted integration with 30% having biallelic integrations (Fig 2d, Extended Data Fig 4D-F, and Supplemental Figure 1B).
We next evaluated progenitor cell capacity of GFPhigh HSPCs using the colony forming unit (CFU) assay. HBB GFPhigh HSPCs formed all types of colonies (erythroid, granulocyte/macrophage, and multi-lineage) to a comparable extent as Mock electroporated (Extended Data Figure 5A-C). We also evaluated frequencies of GFPhigh cells in subpopulations of HSPC16, 35, 36 by immunophenotypic analysis, and observed a significant negative correlation between targeting frequencies and the immunophenotypic primitiveness of the analyzed population (Extended Data Figure 5D and Supplemental Figure 2). To confirm these findings, we employed another strategy to evaluate targeting rates in the primitive HSC population. HSPCs or HSCs were sorted from fresh cord blood, then subjected to HR experiments and we observed a 38% reduction in targeting efficiencies in the HSCs compared to the heterogeneous HSPC population (Extended Data Figure 5E). We next tested whether inefficient targeting of primitive cells could be due to reduced rAAV6 donor availability. HSCs and multi potent progenitors (MPPs) were transduced with scAAV6-SFFV-GFP, and results showed a 5-fold reduction in the number of GFP+ HSCs and MPPs compared to the bulk CD34+ population (Extended Data Fig 5F). Collectively, our data suggest that while HSCs are more difficult to target than progenitor cells, we are achieving HR-editing frequencies above 4% and usually above 10%.
HBB targeting in long-term repopulating HSCs
The current gold standard for HSC function, defined by the capacity to self-renew and form differentiated blood cells, is in vivo engraftment into immunodeficient non-obese diabetic (NOD)-SCID-gamma (NSG) mice. We used HSPCs derived from mobilized peripheral blood (mPB) for such studies because of their high clinical relevance, although these cells have been shown to have reduced engraftment capacity in NSG mice compared to HSPCs derived from fetal liver, cord blood, and bone marrow22, 38. All transplanted mice displayed human engraftment in the bone marrow as measured by the presence of hCD45/HLA-ABC double positive cells 16 weeks post-transplant (Fig 3a and Extended Data Fig 6A-C). While we observed a decrease in human cell chimerism for all treatment groups compared to Mock, all groups with nuclease-treated cells displayed similar chimerism to the rAAV6 only group. We did measure a small, but not statistically significant, decrease for the RNP+AAV GFPhigh group compared to RNP+AAV, which can be explained by transplantation of fewer total cells and fewer phenotypically identified LT-HSCs (Extended Data Fig 5D). There was a significant decrease from RNP+AAV input targeting frequencies (16% in the CD34+ mPB HSPCs, Extended Data Fig 5D) compared to the percent GFP+ cells in the bone marrow at week 16 following transplantation (3.5%) (Fig 3c). This decreases is consistent with previous publications, and immunophenotyping of input cells did in fact show an average of 4% targeting in the CD34+/CD38-/CD90+/CD45RA- population (Extended Data Fig 5D). Despite these observed reductions in vivo, our median rates of HBB gene targeting in human cells in the BM (3.5%) appears to be higher than what was found by others, particularly Hoban et al., and Genovese et al., in which most mice appeared to have <1% gene-modification following transplant using ZFNs targeting HBB and IL2RG, respectively6, 21. In contrast, mice transplanted with RNP GFPhigh cells had a median of 90% GFP+ human cells at Week 16 after transplant, with three mice showing >97% GFP+ human cells (Fig 3a and 3c). We also observed both myeloid (CD33+) and lymphoid (CD19+) reconstitution with a median of 94% and 83% GFP+ cells, respectively (Fig 3c), implicating targeting of multipotent HSCs. We detected 5% and 49% GFP+ human HSPCs (CD34+/CD10-) in the BM of mice transplanted with RNP+AAV and RNP+AAV GFPhigh cells, respectively (Extended Data Fig 7A-C). Multi-parameter flow cytometric analysis showed no perturbations in lineage reconstitution and no evidence of abnormal hematopoiesis, a functional assessment of the safety of the editing procedure. To experimentally determine if we targeted HBB in HSCs, we performed secondary transplants for the RNP+AAV and RNP+AAV GFPhigh groups. For both groups, we detected human cells in the bone marrow of secondary recipients at Week 12-14 after transplant with 7% and 90% GFP+ cells for the RNP+AAV and RNP+AAV GFPhigh group, respectively (Fig 3d). More importantly, we confirmed HBB on-target integration events in human cells sorted from the bone marrow of secondary recipients from GFPhigh and RNP+AAV experimental groups (Fig 3e and Supplemental Figure 3). Collectively, these data confirm that our strategy targets the HBB gene in human HSCs.
We next scaled up the genome editing process to resemble a more clinically relevant HSPC starting cell number. We electroporated 80 million mPB-derived HSPCs with the HBB RNP system, transduced them with either SFFV-GFP or SFFV-tNGFR rAAV6, and then transplanted bulk RNP+AAV, sorted GFPhigh, and tNGFRhigh (enriched by FACS or magnetic microbeads). At 16 weeks post-transplant, all mice displayed engraftment of edited human cells in the BM (Fig 3f). We note that using this large-scale procedure the human cell engraftment was equivalent to “Mock” in our prior experiment (Fig. 3b). While we observed reductions when comparing editing rates in the input cells to engrafted cells in vivo, the HBB-tNGFR mice showed a lower reduction (12% in vitro vs. 7.5% in vivo) than the HBB-GFP mice (10% in vitro vs. 1.9% in vivo), suggesting tNGFR could be a better transgene to evaluate editing of HSCs in vivo (Fig 3g). Furthermore, mice transplanted with enriched targeted HSPCs displayed human cell editing frequencies of 10-75% (three mice) with human engraftment levels ranging from 4-30% (Fig 3f-g). These data highly suggest our methodology can be translated to perform large-scale genome editing in HSCs at the HBB locus.
HBB gene correction in SCD HSPCs
We next tested our methodology to correct the disease-causing E6V mutation in SCD patient-derived CD34+ HSPCs. We first confirmed high frequencies of INDELs (Fig 4a) and HR using an SFFV-GFP donor (Fig 4b) at the HBB locus in SCD HSPCs. We then produced a therapeutic rAAV6 donor (corrective SNP donor) designed to revert the E6V mutation, while also introducing silent mutations to prevent Cas9 re-cutting and premature strand cross over (Extended Data Fig 8A). Targeting SCD HSPCs with the corrective SNP donor reverted an average of 50% of the E6V (HbS) alleles to WT (HbA) alleles (Fig 4c), and analysis ofmethylcellulose clones showed that an average of 45% of clones had at least one HbA allele (Extended Data Fig 8B). We next created an anti-sickling HBB cDNA therapeutic donor (HbAS339) using previously reported strategies13, 14 of knocking in divergent cDNAs into the gene start codon to preserve endogenous promoter/enhancer function, followed by a clinically relevant promoter (EF1α) driving tNGFR expression to allow for enrichment of edited cells (Supplemental Fig 4A). Using this donor, we targeted an average of 11% of SCD patient-derived HSPCs (Fig 4d) and confirmed seamless integration by In-Out PCR (Supplemental Figure 4B). Notably, we observed a tNGFRhigh population as described previously (Fig. 2c), indicating the ability to enrich SCD-corrected HSPCs early in the culture process. Overall, these studies conclude that our methodology can correct the E6V mutation using two different donor designs.
We next tested if the HBB-edited SCD HSPCs maintained their erythroid differentiation potential bysubjecting tNGFRhigh and Mock HSPCs to a 21-day in vitro erythroid differentiation protocol40, 41. Flow cytometric analyses post-erythroid differentiation showed a high proportion of GPA+/CD45-/CD71+/CD34- cells, indicating the presence of mature differentiated erythrocytes that express hemoglobin42 (Fig 4e and Extended Data Fig 9). Finally, to confirm that adult β-globin (HbA) or HbAS3 mRNA was transcribed from edited HBB alleles, we performed RT-qPCR on erythrocytes differentiated from edited SCD HSPCs. Erythrocytes edited with the corrective SNP donor expressed 56% HbA mRNA out of total β-globin mRNA, while erythrocytes edited with the cDNA donor (bulk) expressed 20% HbAS3 mRNA (Fig 4f). Thus the percentage of HbAS3 mRNA (20%) matched or exceeded the percentage of cells modified by the tNGFR cassette (11%) suggesting functional expression of the AS3 cDNA from the endogenous HBB promoter. Notably, erythrocytes differentiated from enriched tNGFRhigh HSPCs expressed 70% HbAS3 mRNA, confirming an enrichment of functionally corrected HSPCs.
Discussion
Our data support the conclusion that HSCs are more resistant to targeted integration by HR than lineage-committed progenitor cells confirming previously published results21. Consequently, enrichment of targeted cells resulted in the removal of the majority of HSCs, leading to an overall 8-fold decrease in the total number of HSCs in the transplanted enriched population (Extended Data Fig 6C). Even though we transplanted 8-fold fewer total HSCs in the enriched population compared to the non-enriched (GFPhigh vs. RNP+AAV), we found there was still an average of 5-fold more absolute number of edited cells in the bone marrow of the mice from the enriched group 16 weeks post-transplant (Extended Data Fig 6C). Hence, our enrichment strategy not only yields higher frequencies of modified cells in the transplanted mice, but the absolute number of modified human cells in the mice was also higher. Thus, the enrichment strategy can ameliorate the problem of inefficient HSC targeting. However, it is important to note that it remains to be determined by future studies in relevant animal models whether engraftment levels of HBB-modified cells would be clinically beneficial for the b-hemoglobinopathies. Nonetheless, recent advances in ex vivo HSC expansion protocols and identification of small molecule drugs, like UM17143 that expands HSCs, might be combined with our strategy to generate a large and highly enriched population of genome-edited HSCs. Future transplant studies may help determine if HSC expansion would be required for clinical translation of our enrichment paradigm.
Our methodology sets the framework for CRISPR-mediated HBB targeting in HSCs that has the power to be translated to the clinic. While GFP is an unsuitable marker for gene therapy, our enrichment protocol using tNGFR (Fig 2c and Fig 3f-g) (or other similar signaling-inert cell surface markers) represents a strategy for the next generation of β-hemoglobinopathy therapies that are based on gene editing. Our studies show that this methodology can enrich corrected SCD patient-derived HSPCs that can differentiate into erythrocytes that express HBB anti-sickling mRNA from the endogenous HBB promoter. This tNGFR selection strategy has the potential advantage over chemoselection strategies that it avoids exposing edited cells and patients to potentially toxic chemotherapy14. The strategy of knocking in a HBB cDNA along with a selectable marker to enrich for modified cells would be applicable to both SCD and almost all forms of b-thalassemia. Furthermore, because we can efficiently scale up the genome editing process to clinically relevant starting numbers, future studies will address developing a GMP-compatible process for editing the HBB locus in HSPCs.
In conclusion, we believe that the presented methodology lays the foundation for CRISPR/Cas9-mediated genome editing therapies not only for the b-hemoglobinopathies, but also for a range of other hematological diseases and generally advances HSC-based cell and gene therapies.
Materials and Methods
AAV vector production
AAV vector plasmids were cloned in the pAAV-MCS plasmid (Agilent Technologies, Santa Clara, CA) containing ITRs from AAV serotype 2. The HBB rAAV6 GFP and tNGFR donor contained promoter, MaxGFP or tNGFR, and BGH polyA. The left and right homology arms for the GFP and tNGFR HBB donors were 540bp and 420bp, respectively. The E6V rAAV6 donor contained 2.2kb of sequence homologous to the sequence upstream of E6V. The nucleotide changes are depicted in Extended Data Figure 2. Immediately downstream of the last nucleotide change was 2.2kb of homologous HBB sequence. HBB cDNA contained same homology arms as GFP and tNGFR donors above except the left homology arm was shortened to end at the sickle mutation. Sequence of full HBB cDNA is depicted in Supplemental Figure 4B. The sickle corrective donor used in the SCD-derived HSPCs in Figure 4 had a total of 2.4kb sequence homology to HBB with the SNPs shown in Extended Data Figure 8a in the center. Self complementary AAV6 (scAAV6) carrying the SFFV promoter driving GFP was kindly provided by Hans-Peter Kiem (Fred Hutchinson Cancer Research Center). AAV6 vectors were produced as described with a few modifications44. Briefly, 293FT cells (Life Technologies, Carlsbad, CA, USA) were seeded at 13x106 cells per dish in ten 15-cm dishes one day before transfection. One 15-cm dish was transfected using standard PEI transfection with 6 μg ITR-containing plasmid and 22 μg pDGM6 (a kind gift from David Russell, University of Washington, Seattle, WA, USA), which contains the AAV6 cap genes, AAV2 rep genes, and adenovirus helper genes. Cells were incubated for 72 hrs until harvest of AAV6 from cells by three freeze-thaw cycles followed by a 45 min incubation with TurboNuclease at 250 U/mL (Abnova, Heidelberg, Germany). AAV vectors were purified on an iodixanol density gradient by ultracentrifugation at 48,000 rpm for 2 h at 18 °C. AAV vectors were extracted at the 60-40% iodixanol interface and dialyzed three times in PBS with 5% sorbitol in the last dialysis using a 10K MWCO Slide-A-Lyzer G2 Dialysis Cassette (Thermo Fisher Scientific, Santa Clara, CA, USA). Vectors were added pluronic acid to a final concentration of 0.001%, aliquoted, and stored at -80°C until use. AAV6 vectors were titered using quantitative PCR to measure number of vector genomes as described here45.
CD34+ hematopoietic stem and progenitor cells
Frozen CD34+ HSPCs derived from bone marrow or mobilized peripheral blood were purchased from AllCells (Alameda, CA, USA) and thawed according to manufacturer’s instructions. CD34+ HSPCs from cord blood were either purchased frozen from AllCells or acquired from donors under informed consent via the Binns Program for Cord Blood Research at Stanford University and used fresh without freezing. CD34+ HSPCs from SCD patients were purified within 24 hours of the scheduled apheresis. For volume reduction via induced rouleaux formation, whole blood was added 6% Hetastarch in 0.9% Sodium Chloride Injection (Hospira, Inc., Lake Forest, IL, USA) in a proportion of 5:1 (v/v). Following a 60 to 90-minute incubation at room temperature, the top layer, enriched for HSPCs and mature leukocytes, was carefully isolated with minimal disruption of the underlying fraction. Cells were pelleted, combined, and resuspended in a volume of PBS with 2mM EDTA and 0.5% BGS directly proportional to the fraction of residual erythrocytes – typically 200-400 mL. MNCs were obtained by density gradient separation using Ficoll and CD34+ HSPCs were purified using the CD34+ Microbead Kit Ultrapure (Miltenyi Biotec, San Diego, CA, USA) according to manufacturer’s protocol. Cells were cultured overnight and then stained for CD34 and CD45 using APC anti-human CD34 (Clone 561; Biolegend, San Jose, CA, USA) and BD Horizon V450 anti-human CD45 (Clone HI30; BD Biosciences, San Jose, CA, USA), and a pure population of HSPCs defined as CD34bright/CD45dim were obtained by cell sorting on a FACS Aria II cell sorter (BD Biosciences, San Jose, CA, USA). All CD34+ HSPCs were cultured in StemSpan SFEM II (Stemcell Technologies, Vancouver, Canada) supplemented with SCF (100 ng/ml), TPO (100 ng/ml), Flt3-Ligand (100 ng/ml), IL-6 (100 ng/ml), and StemRegenin1 (0.75 mM). Cells were cultured at 37°C, 5% CO2, and 5% O2.
Electroporation and transduction of cells
The HBB and IL2RG synthetic sgRNAs used were purchased from TriLink BioTechnologies (San Diego, CA, USA) with chemically modified nucleotides at the three terminal positions at both the 5′and 3′ends. Modified nucleotides contained 2′O-Methyl 3′phosphorothioate and the sgRNA was HPLC-purified. The genomic sgRNA target sequences with PAM in bold are: HBB: 5’-CTTGCCCCACAGGGCAGTAACGG-3’46, 47; IL2RG: 5’-TGGTAATGATGGCTTCAACATGG-3’. Cas9 mRNA containing 5-methylcytidine and pseudouridine was purchased from TriLink BioTechnologies. Cas9 protein was purchased from Life Technologies. Cas9 RNP was made by incubating protein with sgRNA at a molar ratio of 1:2.5 at 25°C for 10 min immediately prior to electroporation. CD34+ HSPCs were electroporated 1-2 days after thawing or isolation. CD34+ HSPCs were electroporated using the Lonza Nucleofector 2b (program U-014) and the Human T Cell Nucleofection Kit (VPA-1002, Lonza) as we have found this combination to be superior in optimization studies. The following conditions were used: 5x106 cells/ml, 300 ug/ml Cas9 protein complexed with sgRNA at 1:2.5 molar ratio, or 100 µg/ml synthetic chemically modified sgRNA with 150 µg/ml Cas9 mRNA (TriLink BioTechnologies, non-HPLC purified). Following electroporation, cells were incubated for 15 min at 37°C after which they were added AAV6 donor vectors at an MOI (vector genomes/cell) of 50,000-100,000 and then incubated at 30°C or 37°C overnight (if incubated at 30°C, plates were then transferred to 37°C) or targeting experiments of freshly sorted HSCs (Extended Data Figure 5E), cells were electroporated using the Lonza Nucleofector 4D (program EO-100) and the P3 Primary Cell Nucleofection Kit (V4XP-3024). For the electroporation of 80 million CD34+ HSPCs, the Lonza 4D-Nucleofector LV unit (program DZ-100) and P3 Primary Cell Kit were used. Subsequently, we have found no benefit to the 30°C incubation and now perform all of our manufacturing at 37°C.
Measuring targeted integration of fluorescent and tNGFR donors
Rates of targeted integration of GFP and tNGFR donors was measured by flow cytometry at least 18 days after electroporation. Targeted integration of a tNGFR expression cassette was measured by flow cytometry of cells stained with APC-conjugated anti-human CD271 (NGFR) antibody (BioLegend, clone: ME20.4). For sorting of GFPhigh or tNGFRhigh populations, cells were sorted on a FACS Aria II SORP using the LIVE/DEAD Fixable Blue Dead Cell Stain Kit (Life Technologies) to discriminate live and dead cells according to manufacturer's instructions.
Positive selection and enrichment of tNGFR+ HSPCs
Positive selection of targeted HSPCs was performed using the CD271 (tNGFR) Microbead Kit (Miltenyi Biotech, Auburn, CA USA), according to the manufacturers’ instructions 72hr post electroporation. Briefly, tNGFR+ cells were magnetically labeled with CD271 Microbeads after which the cell suspension was loaded onto an equilibrated MACS column inserted in the magnetic field of a MACS separator. The columns were washed three times, and enriched cells were eluted by removing the column from the magnetic field and eluting with PBS. Enrichment was determined by flow cytometry during culture for 2-3 weeks by FACS analysis every 3 days.
Immunophenotyping of targeted HSPCs
Harvested wells were stained with LIVE/DEAD Fixable Blue Dead Cell Stain (Life Technologies) and then with anti human CD34 PE-Cy7 (581, BioLegend), CD38 Alexa Fluor 647 (AT1, Santa Cruz Biotechnologies, Santa Cruz, CA, USA), CD45RA BV 421 (HI100, BD Biosciences), and CD90 BV605 (5E10, BioLegend) and analyzed by flow cytometry. For sorting of CD34+ or CD34+/CD38-/CD90+ cells, CB-derived CD34+ HSPCs were stained directly after isolation from blood with anti human CD34 FITC (8G12, BD Biosciences), CD90 PE (5E10, BD Biosciences), CD38 APC (HIT2, BD Bioscience), and cells were sorted on a FACS Aria II (BD Bioscience), cultured overnight, and then electroporated with HBB RNP and transduced with HBB GFP rAAV6 using our optimized parameters.
Measuring targeted integration of the E6V donor
For assessing the allele modification frequencies in samples with targeted integration of the E6V rAAV6 donor, PCR amplicons spanning the targeted region (see Extended Data Figure 2A) were created using one primer outside the donor homology arm and one inside: HBB_outside 5’-GGTGACAATTTCTGCCAATCAGG -3’ and HBB_inside: 5’-GAATGGTAGCTGGATTGTAGCTGC-3’. The PCR product was gel-purified and re-amplified using a nested primer set (HBB_nested_fw: 5’-GAAGATATGCTTAGAACCGAGG-3’ and HBB_nested_rw: 5’-CCACATGCCCAGTTTCTATTGG-3’) to create a 685bp PCR amplicon (see Extended Data Figure 2A) that was gel-purified and cloned into a TOPO plasmid using the Zero Blunt TOPO PCR Cloning Kit (Life Technologies) according to the manufacturer's protocol. TOPO reactions were transformed into XL-1 Blue competent cells, plated on kanamycin-containing agar plates, and single colonies were sequenced by McLab (South San Francisco, CA, USA) by rolling circle amplification followed by sequencing using the following primer: 5′-GAAGATATGCTTAGAACCGAGG-3′. For each of the six unique CD34+ donors used in this experiment, 100 colonies were sequenced. Additionally, 100 colonies derived from an AAV only sample were sequenced and detected no integration events.
Measuring INDEL frequencies
INDEL frequencies were quantified using the TIDE software48 (Tracking of Indels by Decomposition) and sequenced PCR-products obtained by PCR of genomic DNA extracted at least four days following electroporation as previously described15.
Methylcellulose colony-forming unit (CFU) assay
The CFU assay was performed by FACS sorting of single cells into 96-well plates containing MethoCult Optimum (Stemcell Technologies) four days after electroporation and transduction. After 12-16 days, colonies were counted and scored based on their morphological appearance in a blinded fashion.
Genotyping of Methylcellulose colonies
DNA was extracted from colonies formed in methylcellulose from FACS sorting of single cells into 96-well plates. Briefly, PBS was added to wells with colonies, and the contents were mixed and transferred to a U-bottomed 96-well plate. Cells were pelleted by centrifugation at 300xg for 5min followed by a wash with PBS. Finally, cells were resuspended in 25 µl QuickExtract DNA Extraction Solution (Epicentre, Madison, WI, USA) and transferred to PCR plates, which were incubated at 65°C for 10 min followed by 100°C for 2 min. Integrated or non-integrated alleles were detected by PCR. For detecting HBB GFP integrations at the 3’ end, two different PCRs were set up to detect integrated (one primer in insert and one primer outside right homology arm) and non-integrated alleles (primer in each homology arm), respectively (see Extended Data Figure 4A). HBB_int_fw: 5’-GTACCAGCACGCCTTCAAGACC-3’, HBB_int_rv: 5’-GATCCTGAGACTTCCACACTGATGC-3’, HBB_no_int_fw: 5’-GAAGATATGCTTAGAACCGAGG-3’, HBB_no_int_rv: 5’-CCACATGCCCAGTTTCTATTGG-3’. For detecting HBB tNGFR integrations at the 5’ end, a 3-primer PCR methodology was used to detect the integrated and non-integrated allele simultaneously (see Extended Data Figure 4D). HBB_outside_5’Arm_fw: GAAGATATGCTTAGAACCGAGG, SFFV_rev: ACCGCAGATATCCTGTTTGG HBB_inside_3’Arm_rev: CCACATGCCCAGTTTCTATTGG. Note that for the primers assessing non-integrated alleles, the Cas9 cut site is at least 90bp away from the primer binding sites (PBSs) and since CRISPR/Cas9 generally introduces INDELs of small sizes, the PBSs should only very rarely be disrupted by an INDEL.
Transplantation of CD34+ HSPCs into NSG mice
For in vivo studies, 6 to 8 week-old NOD scid gamma (NSG) mice were purchased from the Jackson laboratory (Bar Harbor, ME USA). The experimental protocol was approved by Stanford University’s Administrative Panel on Lab Animal Care. Sample sizes were not chosen to ensure adequate power to detect a pre-specified effect size. Four days after electroporation/transduction or directly after sorting, 500,000 cells (or 100,000-500,000 cells for the GFPhigh group) were administered by tail-vein injection into the mice after sub-lethal irradiation (200 cGy) using an insulin Syringe with a 27 gauge x 1/2" needle. Mice were randomly assigned to each experimental group and evaluated in a blinded fashion. For secondary transplants, human cells from the RNP+AAV group were pooled and CD34+ cells were selected using a CD34 bead enrichment kit (MACS CD34 MicroBead Kit UltraPure, human, Miltenyi Biotec), and finally cells were injected into the femurs of female secondary recipients (3 mice total). Because GFPhigh mice had low engraftment, they were not CD34+-selected, but total mononuclear cells were filtered, pooled, and finally injected into the femur of two secondary recipients.
Assessment of human engraftment
At Week 16 post transplantation, mice were sacrificed, total mouse bone marrow (BM) (2x femur, 2x tibia, 2x humerus, sternum, 2x pelvis, spine) was collected and crushed using mortar and pestle. Mononuclear cells (MNCs) were enriched using Ficoll gradient centrifugation (Ficoll-Paque Plus, GE Healthcare, Sunnyvale, CA, USA) for 25min at 2,000xg, room temperature. Cells were blocked for nonspecific antibody binding (10% vol/vol, TruStain FcX, BioLegend) and stained (30min, 4°C, dark) with monoclonal anti human CD45 V450 (HI30, BD Biosciences), CD19 APC (HIB19, BD Biosciences), CD33 PE (WM53, BD Biosciences), HLA-ABC APC-Cy7 (W6/32, BioLegend), anti mouse CD45.1 PE-Cy7 (A20, eBioScience, San Diego, CA, USA), anti mouse PE-Cy5 mTer119 (TER-119, eBioscience) antibodies. Normal multi-lineage engraftment was defined by the presence of myeloid cells (CD33+) and B-cells (CD19+) within engrafted human CD45+/ HLA-ABC+ cells. Parts of the mouse BM were used for CD34-enrichment (MACS CD34 MicroBead Kit UltraPure, human, Miltenyi Biotec) and the presence of human hematopoietic stem and progenitor cells (HSPCs) was assessed by staining with anti human CD34 APC (8G12, BD Biosciences), CD38 PE-Cy7 (HB7, BD Biosciences), CD10 APC-Cy7 (HI10a, BioLegend), and anti mouse CD45.1 PE-Cy5 (A20, eBioScience) and analyzed by flow cytometry. The estimation of the total number of modified human cells in the bone marrow (BM) at week 16 post-transplant was calculated by multiplying percent engraftment with percent GFP+ cells among engrafted cells. This number was multiplied by the total number of MNCs in the BM of a NSG mouse (1.1x108 per mouse) to give the total number of GFP+ human cells in the total BM of the transplanted mice. The total number of MNCs in the BM of a NSG mouse was calculated by counting the total number of MNCs in one femur in four NSG mice. The total number of MNCs in one mouse was then calculated assuming one femur is 6.1% of the total marrow as found in49.
Differentiation of CD34+ HSPCs into erythrocytes in vitro
SCD patient-derived HSPCs were cultured in three phases following targeting at 37°C and 5% CO2 in SFEM II media according to previously established protocols40, 41. Media was supplemented with 100 U/mL penicillin/streptomycin, 2mM L glutamine, 40 µg/mL lipids, 100 ng/mL SCF, 10 ng/mL IL-3 (PeproTech), 0.5 U/mL erythropoietin (eBiosciences), and 200 µg/mL transferrin (Sigma Aldrich). In the first phase, corresponding to days 0-7 (Day 0 being Day 4 post-electroporation), cells were cultured at 105 cells/mL. In the second phase, corresponding to days 7-11, cells were maintained at 105 cells/mL and erythropoietin was increased to 3 U/mL. In the third and final phase, days 11-21, cells were cultured at 106 cells/mL with 3 U/mL of erythropoietin and 1 mg/mL of transferrin. Erythrocyte differentiation of edited and non-edited HSPCs was assessed by flow cytometry using the following antibodies: hCD45 V450 (HI30, BD Biosciences), CD34 FITC (8G12, BD Biosciences), CD71 PE-Cy7 (OKT9, Affymetrix), and CD235a PE (GPA) (GA-R2, BD Biosciences).
Assessment of mRNA levels in differentiated erythrocytes
RNA was extracted from 100,000-250,000 differentiated erythrocytes between days 16-21 of erythroid differentiation using the RNeasy Mini Kit (Qiagen, Hilden, Germany) and was DNase-treated with RNase-Free DNase Set (Qiagen). cDNA was made from 100ng RNA using the iScript Reverse Transcription Supermix for RT-qPCR (Bio-Rad, Hercules, CA). Levels of HbS, HbA (from corrective SNP donor), and HbA-AA (anti-sickling HBB cDNA donor) were quantified by qPCR using the following primers and FAM/ZEN/IBFQ-labeled hydrolysis probes purchased as custom-designed PrimeTime qPCR Assays from IDT (San Jose, CA): HbS primer (fw): 5’ TCACTAGCAACCTCAAACAGAC 3’, HbS primer (rv): 5’ ATCCACGTTCACCTTGCC 3’, HbS probe: 5’ TAACGGCAGACTTCTCCACAGGAGTCA 3’, HbA primer (fw): 5’ TCACTAGCAACCTCAAACAGAC 3’, HbA primer (rv): 5’ ATCCACGTTCACCTTGCC 3’, HbA probe: 5’ TGACTGCGGATTTTTCCTCAGGAGTCA 3’, HbAS3 primer fw: 5’ GTGTATCCCTGGACACAAAGAT 3’, HbAS3 primer (rv): 5’ GGGCTTTGACTTTGGGATTTC 3’, HbAS3 probe: 5’ TTCGAAAGCTTCGGCGACCTCA 3’. Primers for HbA and HbS are identical, but probes differ by six nucleotides, and therefore it was experimentally confirmed that these two assays do not cross-react with targets. To normalize for RNA input, levels of the reference gene RPLP0 was determined in each sample using IDT’s predesigned RPLP0 assay (Hs.PT.58.20222060). qPCR reactions were carried out on a LightCycler 480 II (Roche, Basel, Schwitzerland) using the SsoAdvanced Universal Probes Supermix (BioRad) following manufacturer’s protocol and PCR conditions of 10 minutes at 95°C, 50 cycles of 15 seconds at 95°C and 60 seconds at 58°C. Relative mRNA levels were determined using the relative standard curve method, in which a standard curve for each gene was made from serial dilutions of the cDNA. The standard curve was used to calculate relative amounts of target mRNA in the samples relative to levels of RPLP0.
Extended Data
Acknowledgments
D.P.D was supported through the Stanford Child Health Research Institute (CHRI) Grant and Postdoctoral Award. R.O.B. was supported through an Individual Postdoctoral grant (DFF–1333-00106B) and a Sapere Aude, Research Talent grant (DFF–1331-00735B) both from the Danish Council for Independent Research, Medical Sciences. M.H.P. gratefully acknowledges the support of the Amon Carter Foundation, the Laurie Krauss Lacob Faculty Scholar Award in Pediatric Translational Research and NIH grant support PN2EY018244, R01-AI097320, and R01-AI120766. We thank David Russell (University of Washington) for the pDGM6 plasmid, Hans-Peter Kiem (Fred Hutchinson Cancer Research Center) for scAAV6, Gustavo de Alencastro and Mark Kay (Stanford University) for help with AAV production, the Binns Program for Cord Blood Research (Stanford University) for cord blood-derived CD34+ HSPCs. We also thank Lonza for donating the LV unit for performing large-scale genome editing studies. We further thank members of the Porteus lab, David DiGiusto (Stanford University), and Maria Grazia Roncarolo (Stanford University) for helpful input, comments, and discussion.
Footnotes
Competing Financial Interests:
MHP is a consultant and has equity interest in CRISPR Tx, but CRISPR Tx had no input into the design, execution, interpretation or publication of the results herein. Nobuko Uchida is an employee of Stem Cells, Inc, but they had no input into this manuscript.
Author Contributions:
D.P.D. and R.O.B. contributed equally to this work as well as performed and designed most of the experiments. D.P.D., R.O.B., A.R., and C.E.N. designed, executed and analyzed engraftment studies. J.C. performed some HBB HR, NHEJ and tNGFR experiments. G.W. performed in vitro erythrocyte differentiation experiments. MPD assisted with large-scale electroporation experiments. N.S. ran and analyzed HSPC immunophenotyping experiments. A.B.W. scored and harvested methylcellulose clones. N.U. sorted freshly isolated HSCs prior to targeting. S.M. purified CD34+ HSPCs from peripheral blood of SCD patients. A.N. was the attending physician who oversaw transfusions of SCD patients. A.H., R.M., and K.I.W. contributed to experimental design and data interpretation. M.H.P directed the research and participated in the design and interpretation of the experiments and the writing of the manuscript. D.P.D and R.O.B. wrote the manuscript with help from all authors.